WEEK 5~ Human Variation & Race

Cold:

The environmental stress negatively impacts survival of human during cold weather by, less sunlight bring lower vitamin D.  Your genome expression changes from season to season, in the cold it will boost your immune system simply because it is flu season.  More severe would be hypothermia, it is a life threatening condition that can result in death due to a drop in the body’s core temperature which is less than 95*F.  (A normal body temperature is between 97.7-99.5)

If the body is exposed to cold and it can not warm itself up, a drop in the core body temperature will occur.  First the body will start to shiver, blushed lips and extremities, finally some mental confusion. There are different types of Hypothermia from mild, moderate to severe resulting in death. During extreme cold the body receives a signal form the sensory receptors up to the brain, then to the body and try to maintain the vital organ to heat properly.  Homeostasis is interrupted from its stable condition which then the body is in danger.

Hypothermia depends on human to human, Elderly people and children are more susceptible to hypothermia due to less body fat and are more fragile. 

goose bumps

2A) Short Term:  Adrenal glands produced adrenaline which caused the pili muscles attached to hair follicles to contract and making the hair stand up causing goose bumps.  The hair trapped more air which prevents body heat from escaping keeping the body warm.

2B) Facultative Adaptation:  If I live in California, then I will be in warmer climate where my body will not have to deal with extreme cold.

2C) Developmental Adaptations:    Eskimos Hunted for all their food, they would stock up for winter and used every part of the animal for foo and clothing to stay warm

3D)Cultural Adaptations: I will give an example of my cultural that has been passed down since my great-grandmother.  When it is cold out we will make a huge pot of Albondigas.  This is our go to food for when it is cold out along with it being a comfort food.  When we are cold and feel a cold coming on we put Vick's on our chest and feet and cover up very warm (to let the cold out of our bodies, grandmothers beliefs).  This helps us stay warm and healthy.

3) Benefits of studying the human variation:  Studying human variation can give us knowledge on the pros and cons in how we do things in our world so we can change it as we move into the future for our own well being.

Learning from each other and our past ancestors can help us come up with new medicine, new ways to help with the environment and help us with natural disasters.

4). I don't feel race would better make me understand the variations of adaptations but maybe more the environment and  the cultural they live in.  If they live is freezing cold temperatures we can learn how they adapt to weather to stay warm to survive. Also using new and old methods and finding out what works best.

Week 4 Piltdown Hoax

The Piltdown Hoax: 1912 Near the Southern English town of Lewes in the little Village of Piltdown, Charles Dawson claimed to have found a piece of a human skull. He shared  his findings with two men,  geologist Arthur Smith Woodward of the Natural History Museum and French Paleontologist Pierre Tay.  The scientific significance was that Dawson thought he found the link between apes and humans.  The hoax was discovered in the 1950’s where they had better dating methods and they launched the first scale analysis.  They were able to proof that the teeth were filed down due to scratch marks and that the jaw was not of a human but a orangutan.      

  Scientist were curious and excited to these finding that they wanted to believe it was true as  they did not have the proper knowledge of  human evolution.  Therefore their faults were  they didn’t want to challenge each other.

 Due to better methods of testing, Dr. Kenneth Oakley of the MNH applied an entirely new method of dating fossils, “the fluorine method”   fluorine is absorbed by bones from water and soil which they are buried in.  The Piltdown jaw and the skull did not match, and drilling into the jaw gave a smell of a more recent bone where the skull did not have the same smell letting them know it was older that the jaw itself.  A clear distinction that they were very different.  They also conducted a “Nitrogen test”. nitrogen distilled as ammonia.  Once again two separate creatures were shown.  Dr. JS Weiner also assisted Dr. Oakley with these findings.

I do not believe removing “humans” would reduce less chance of errors, evolving with new ways such as new machinery and humans operating the machinery would be a good balance.  

Humans bouncing ideas from each other is a great way so get answers and then using machinery to put it to the test.  

Life lessons: for me would be, don’t  always take what someone says at face value.  Always try to find your own facts buy reading, using your critical thinking skills, for example if you know your body is not feeling well and you go to your Doctor and he/she tries to tell you that you're fine, you must go with your gut and ask for more testing. (true story)

week 3 Analogy/Homology

Analogy/Homology

Analogous Traits: Similar traits between organism such as birds
butterflies with wings and able to fly yet have no common evolutionary descent.

Homologous Traits: two or more different species that are similar that come from a common ancestor.

They could have the similarities in bone structure, DNA sequences or anatomical structures.

Homologs

Human and bird forearms , these organisms even though the bird can fly and the human body can not fly they are very similar  (bird, Human) every forearm bone is similar, such as the.... Humerus, radius, Ulna, Carpals, Metacarpals and Phalange.  Humans are covered with skin as birds are covered with feathers.  Humans use their forearms to pick up things, swing a bat, while Birds use their forearms to fly.  Common ancestor is the reptile.

Analogy

A bee and a bat would be Analogous species.  A bee being an insect and a bat being a  mammal, yet both have wings that are used for flying. A bee's wing has a fore wing and a hind wing where as a bat has the same bones has a human's forearm, upper arm bone, lower arm bone, wrist bones, metacarpals and fingers. They have separate evolutionary origins, yet both can fly. 

They did inherit forelimbs from a common ancestor.

WEEK 2- Protein Synthesis

CATTACTTGGAACTGCGCAACCAGATCTTT

Scientific Method Scenario

1)  The student might be working the graveyard shift and only getting a couple hours of sleep before entering the classroom.

2)  Test:

     a)   I would  suggest that he move up in front of the class and keep himself engaged by asking questions and participating more, advise him not to eat to heavy as that makes everyone sleepy.
     b). If  moving to the front of the class and participating more will keep him from falling asleep.
That would support a testable hypothesis.
     c)  If that does not work, then that would be a falsified hypothesis.
3) An untestable example would be his head become heavier at a certain time of day and he can't keep it up which puts him to sleep.

If I were stranded on a desert island, the two items I would take with me, would be a fire starter and a pan.  A fire starter to make a fire, stay warm and boil my water in my pan I brought with me to keep hydrated and safe by drinking clean water.